Review



stat3 expression construct plegfp wt stat3 oncogene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc stat3 expression construct plegfp wt stat3 oncogene
    Stat3 Expression Construct Plegfp Wt Stat3 Oncogene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pLEGFP-WT-STAT3+(Plasmid+%2371450)/pm40247082-88-0-8
    Average 93 stars, based on 21 article reviews
    stat3 expression construct plegfp wt stat3 oncogene - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: The interferon γ pathway enhances pluripotency and X-chromosome reactivation in iPSC reprogramming
    Article Snippet: Gibson cloning ( ) was used to generate a Lenti-i Stat3-BFP containing the TRE (doxycycline inducible) promoter followed by the Stat3 mouse cDNA, a T2A, and a BFP sequence (available from Addgene, plasmid #216870, https://www.addgene.org/216870/ ). .. For this, DNA fragments were amplified by PCR: Stat3 sequence from cDNA from mouse E14 cells, the backbone containing a TRE promoter and a WPRE sequence from the pLV-TRE plasmid (A.B. laboratory), and the T2A-BFP sequence from the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP plasmid [a gift from K. Yusa (Addgene plasmid #50946; http://n2t.net/addgene:50946 ; RRID:Addgene_50946)] ( ). .. PCR was performed using a PrimeStar HS DNA Polymerase (Takara, R010A), adapting the annealing temperatures and extension time following the manufacturer’s instructions.

    Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma
    Article Snippet: .. STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids. ..

    Polymerase Chain Reaction:

    Article Title: The interferon γ pathway enhances pluripotency and X-chromosome reactivation in iPSC reprogramming
    Article Snippet: Gibson cloning ( ) was used to generate a Lenti-i Stat3-BFP containing the TRE (doxycycline inducible) promoter followed by the Stat3 mouse cDNA, a T2A, and a BFP sequence (available from Addgene, plasmid #216870, https://www.addgene.org/216870/ ). .. For this, DNA fragments were amplified by PCR: Stat3 sequence from cDNA from mouse E14 cells, the backbone containing a TRE promoter and a WPRE sequence from the pLV-TRE plasmid (A.B. laboratory), and the T2A-BFP sequence from the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP plasmid [a gift from K. Yusa (Addgene plasmid #50946; http://n2t.net/addgene:50946 ; RRID:Addgene_50946)] ( ). .. PCR was performed using a PrimeStar HS DNA Polymerase (Takara, R010A), adapting the annealing temperatures and extension time following the manufacturer’s instructions.

    Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma
    Article Snippet: .. STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids. ..

    Sequencing:

    Article Title: The interferon γ pathway enhances pluripotency and X-chromosome reactivation in iPSC reprogramming
    Article Snippet: Gibson cloning ( ) was used to generate a Lenti-i Stat3-BFP containing the TRE (doxycycline inducible) promoter followed by the Stat3 mouse cDNA, a T2A, and a BFP sequence (available from Addgene, plasmid #216870, https://www.addgene.org/216870/ ). .. For this, DNA fragments were amplified by PCR: Stat3 sequence from cDNA from mouse E14 cells, the backbone containing a TRE promoter and a WPRE sequence from the pLV-TRE plasmid (A.B. laboratory), and the T2A-BFP sequence from the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP plasmid [a gift from K. Yusa (Addgene plasmid #50946; http://n2t.net/addgene:50946 ; RRID:Addgene_50946)] ( ). .. PCR was performed using a PrimeStar HS DNA Polymerase (Takara, R010A), adapting the annealing temperatures and extension time following the manufacturer’s instructions.

    Plasmid Preparation:

    Article Title: The interferon γ pathway enhances pluripotency and X-chromosome reactivation in iPSC reprogramming
    Article Snippet: Gibson cloning ( ) was used to generate a Lenti-i Stat3-BFP containing the TRE (doxycycline inducible) promoter followed by the Stat3 mouse cDNA, a T2A, and a BFP sequence (available from Addgene, plasmid #216870, https://www.addgene.org/216870/ ). .. For this, DNA fragments were amplified by PCR: Stat3 sequence from cDNA from mouse E14 cells, the backbone containing a TRE promoter and a WPRE sequence from the pLV-TRE plasmid (A.B. laboratory), and the T2A-BFP sequence from the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP plasmid [a gift from K. Yusa (Addgene plasmid #50946; http://n2t.net/addgene:50946 ; RRID:Addgene_50946)] ( ). .. PCR was performed using a PrimeStar HS DNA Polymerase (Takara, R010A), adapting the annealing temperatures and extension time following the manufacturer’s instructions.

    Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma
    Article Snippet: .. STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids. ..

    Article Title: Induction of IL6/STAT3-dependent TRAIL expression that contributes to the therapeutic efficacy of osimertinib in EGFR mutant NSCLC cells.
    Article Snippet: The third-generation mutation-selective EGFR tyrosine kinase inhibitor (EGFR-TKI) osimertinib (or AZD9291) effectively induces apoptosis in EGFR mutant (EGFRm) non-small cell lung cancer (NCSLC) cells.. However, the underlying mechanisms have not been fully elucidated.. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL or TNFSF10) is known as a death ligand that initiates apoptosis via binding to its cell surface death receptors such as DR5.

    Mutagenesis:

    Article Title: The CDK4/6-EZH2 pathway is a potential therapeutic target for psoriasis
    Article Snippet: .. Mutation of STAT3 at K49, K140, and K180 was performed by site-directed mutagenesis of the human STAT3 pcDNA3 construct from Addgene (catalog 71447), which was previously cloned into the Strep-tagged backbone (pEXPR-IBA103). ..

    Article Title: The CDK4/6-EZH2 pathway is a potential therapeutic target for psoriasis
    Article Snippet: .. Mutation of STAT3 at K49, K140, and K180 was performed by site-directed mutagenesis of the human STAT3 pcDNA3 construct from Addgene (catalog 71447), which was previously cloned into the Strep-tagged backbone (pEXPR-IBA103). ..

    Construct:

    Article Title: The CDK4/6-EZH2 pathway is a potential therapeutic target for psoriasis
    Article Snippet: .. Mutation of STAT3 at K49, K140, and K180 was performed by site-directed mutagenesis of the human STAT3 pcDNA3 construct from Addgene (catalog 71447), which was previously cloned into the Strep-tagged backbone (pEXPR-IBA103). ..

    Article Title: The CDK4/6-EZH2 pathway is a potential therapeutic target for psoriasis
    Article Snippet: .. Mutation of STAT3 at K49, K140, and K180 was performed by site-directed mutagenesis of the human STAT3 pcDNA3 construct from Addgene (catalog 71447), which was previously cloned into the Strep-tagged backbone (pEXPR-IBA103). ..

    Article Title: Acetone Extract of Cornus officinalis Leaves Exerts Anti-Melanoma Effects via Inhibiting STAT3 Signaling
    Article Snippet: .. The STAT3-C Flag pRc/CMV construct was obtained from Addgene (USA). .. A375 cells were transfected with empty vector and the STAT3C-expressing construct for 48 h and cultured in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin and G418 (300 μg/mL, 345810, EMD Millipore Corp).

    Article Title: Induction of IL6/STAT3-dependent TRAIL expression that contributes to the therapeutic efficacy of osimertinib in EGFR mutant NSCLC cells.
    Article Snippet: The third-generation mutation-selective EGFR tyrosine kinase inhibitor (EGFR-TKI) osimertinib (or AZD9291) effectively induces apoptosis in EGFR mutant (EGFRm) non-small cell lung cancer (NCSLC) cells.. However, the underlying mechanisms have not been fully elucidated.. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL or TNFSF10) is known as a death ligand that initiates apoptosis via binding to its cell surface death receptors such as DR5.

    Clone Assay:

    Article Title: The CDK4/6-EZH2 pathway is a potential therapeutic target for psoriasis
    Article Snippet: .. Mutation of STAT3 at K49, K140, and K180 was performed by site-directed mutagenesis of the human STAT3 pcDNA3 construct from Addgene (catalog 71447), which was previously cloned into the Strep-tagged backbone (pEXPR-IBA103). ..

    Article Title: The CDK4/6-EZH2 pathway is a potential therapeutic target for psoriasis
    Article Snippet: .. Mutation of STAT3 at K49, K140, and K180 was performed by site-directed mutagenesis of the human STAT3 pcDNA3 construct from Addgene (catalog 71447), which was previously cloned into the Strep-tagged backbone (pEXPR-IBA103). ..

    Expressing:

    Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma
    Article Snippet: .. STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids. ..

    Article Title: Induction of IL6/STAT3-dependent TRAIL expression that contributes to the therapeutic efficacy of osimertinib in EGFR mutant NSCLC cells.
    Article Snippet: The third-generation mutation-selective EGFR tyrosine kinase inhibitor (EGFR-TKI) osimertinib (or AZD9291) effectively induces apoptosis in EGFR mutant (EGFRm) non-small cell lung cancer (NCSLC) cells.. However, the underlying mechanisms have not been fully elucidated.. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL or TNFSF10) is known as a death ligand that initiates apoptosis via binding to its cell surface death receptors such as DR5.

    other:

    Article Title: A traditional prescription comprising Astragali Radix and Schisandra chinensis Fructus induces apoptosis and protective autophagy in hepatocellular carcinoma cells.
    Article Snippet: Ethnopharmacological relevance: Hepatocellular carcinoma (HCC) poses a growing challenge to global health efforts.. The 5-year survival rate of HCC patients is still dismal.. A traditional prescription Qi-Wei-Wan (QWW) comprising Astragali Radix and Schisandra chinensis Fructus has traditionally been used for HCC treatment according to traditional Chinese medicine theory, but the pharmacological basis is not clear.



    Similar Products

    96
    OriGene stat3 expression construct
    Stat3 Expression Construct, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pCMV6-XL4+Mammalian+Expression+Vector/pm42162632-58-3-16
    Average 96 stars, based on 1 article reviews
    stat3 expression construct - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc stat3 expression construct plegfp wt stat3 oncogene
    Stat3 Expression Construct Plegfp Wt Stat3 Oncogene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pLEGFP-WT-STAT3+(Plasmid+%2371450)/pm40247082-88-0-8
    Average 93 stars, based on 1 article reviews
    stat3 expression construct plegfp wt stat3 oncogene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Shanghai Genechem Ltd lentiviral expression constructs human stat3
    A , B Role of <t>ELK1,</t> STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.
    Lentiviral Expression Constructs Human Stat3, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pcdna3+1/pmc11904182-358-6-35
    Average 90 stars, based on 1 article reviews
    lentiviral expression constructs human stat3 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Genechem stat3-expression construct nm_139276
    A , B Role of <t>ELK1,</t> STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.
    Stat3 Expression Construct Nm 139276, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/stat3+shrna/pmc11008271-159-0-13
    Average 90 stars, based on 1 article reviews
    stat3-expression construct nm_139276 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology shrna stat3 expressing vectors construction
    A , B Role of <t>ELK1,</t> STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.
    Shrna Stat3 Expressing Vectors Construction, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/Stat3/ppr0746723-65-0-15
    Average 96 stars, based on 1 article reviews
    shrna stat3 expressing vectors construction - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    OriGene green fluorescence protein gfp labeled stat3 expression construct
    Figure 2. Analysis of <t>STAT3</t> in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).
    Green Fluorescence Protein Gfp Labeled Stat3 Expression Construct, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pCMV6-XL4+Mammalian+Expression+Vector/pm35884913-46-1-16
    Average 96 stars, based on 1 article reviews
    green fluorescence protein gfp labeled stat3 expression construct - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc flag stat3c catalog 8722 expression constructs
    Figure 2. Analysis of <t>STAT3</t> in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).
    Flag Stat3c Catalog 8722 Expression Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/Stat3-C+Flag+pRc%2FCMV+(Plasmid+%238722)/10__1172_slash_jci134217-286-7-15
    Average 93 stars, based on 1 article reviews
    flag stat3c catalog 8722 expression constructs - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc constitutively active stat3 expression construct stat3-c flag prc/cmv
    Shikonin inhibited <t>STAT3</t> signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.
    Constitutively Active Stat3 Expression Construct Stat3 C Flag Prc/Cmv, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/stat3+cdna+kiaa1524/pmc07267064-85-1-11
    Average 90 stars, based on 1 article reviews
    constitutively active stat3 expression construct stat3-c flag prc/cmv - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Addgene inc construct expressing constitutively active stat3 mutant pstat3-c
    Shikonin inhibited <t>STAT3</t> signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.
    Construct Expressing Constitutively Active Stat3 Mutant Pstat3 C, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/stat3+cdna+kiaa1524/pm29901084-53-4-14
    Average 90 stars, based on 1 article reviews
    construct expressing constitutively active stat3 mutant pstat3-c - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    A , B Role of ELK1, STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.

    Journal: Cell Death & Disease

    Article Title: Both direct and indirect suppression of MCL1 synergizes with BCLXL inhibition in preclinical models of gastric cancer

    doi: 10.1038/s41419-025-07481-8

    Figure Lengend Snippet: A , B Role of ELK1, STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.

    Article Snippet: The GV492 lentiviral expression constructs of human ELK1, ELK3, ELK4, STAT3, SRF, as well as the GV366 (C-terminally HA-tagged) and GV657 (C-terminally Flag-tagged) constructs for transient expression of human STAT3 and SRF were purchased from Shanghai Genechem Co., Ltd.

    Techniques: Activity Assay, Expressing, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Luciferase, Binding Assay, Control, Co-Immunoprecipitation Assay, Transfection, Immunoprecipitation, Over Expression, Inhibition

    Figure 2. Analysis of STAT3 in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).

    Journal: Biomedicines

    Article Title: Downregulation of STAT3 in Epstein-Barr Virus-Positive Hodgkin Lymphoma.

    doi: 10.3390/biomedicines10071608

    Figure Lengend Snippet: Figure 2. Analysis of STAT3 in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).

    Article Snippet: A green fluorescence protein (GFP)-labeled STAT3 expression construct was cloned into vector pCMV6-XL4 and obtained from Origene (Wiesbaden, Germany).

    Techniques: Western Blot, Control, Microscopy, Staining, Expressing, Labeling, Transfection, Derivative Assay

    Figure 4. Knockdown and stimulation studies in AM-HLH and L-540. (A) SiRNA-mediated knock- down of IRF4 in AM-HLH resulted in elevated expression of STAT3 as analyzed by RQ-PCR (left). The

    Journal: Biomedicines

    Article Title: Downregulation of STAT3 in Epstein-Barr Virus-Positive Hodgkin Lymphoma.

    doi: 10.3390/biomedicines10071608

    Figure Lengend Snippet: Figure 4. Knockdown and stimulation studies in AM-HLH and L-540. (A) SiRNA-mediated knock- down of IRF4 in AM-HLH resulted in elevated expression of STAT3 as analyzed by RQ-PCR (left). The

    Article Snippet: A green fluorescence protein (GFP)-labeled STAT3 expression construct was cloned into vector pCMV6-XL4 and obtained from Origene (Wiesbaden, Germany).

    Techniques: Knockdown, Expressing

    Figure 6. Summary of the results from this study showing a gene regulatory network around STAT3. Genomic amplifications targeting particular genes are highlighted by a red background. Elevated genes are indicated in red, low level expressed genes in green while medium level expressed genes are shown in black. Functional consequences including immune escape, EBV activity, proliferation and survival are highlighted by a blue background. Bold lines indicate relationships demonstrated in this study while slight lines refer to published data.

    Journal: Biomedicines

    Article Title: Downregulation of STAT3 in Epstein-Barr Virus-Positive Hodgkin Lymphoma.

    doi: 10.3390/biomedicines10071608

    Figure Lengend Snippet: Figure 6. Summary of the results from this study showing a gene regulatory network around STAT3. Genomic amplifications targeting particular genes are highlighted by a red background. Elevated genes are indicated in red, low level expressed genes in green while medium level expressed genes are shown in black. Functional consequences including immune escape, EBV activity, proliferation and survival are highlighted by a blue background. Bold lines indicate relationships demonstrated in this study while slight lines refer to published data.

    Article Snippet: A green fluorescence protein (GFP)-labeled STAT3 expression construct was cloned into vector pCMV6-XL4 and obtained from Origene (Wiesbaden, Germany).

    Techniques: Functional Assay, Activity Assay

    Shikonin inhibited STAT3 signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Inhibition of the STAT3 Signaling Pathway Contributes to the Anti-Melanoma Activities of Shikonin

    doi: 10.3389/fphar.2020.00748

    Figure Lengend Snippet: Shikonin inhibited STAT3 signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.

    Article Snippet: Constitutively active STAT3 expression construct STAT3-C Flag pRc/CMV was obtained from Addgene (USA).

    Techniques: Concentration Assay, Expressing, Western Blot, Software, Incubation, Immunofluorescence

    Shikonin down-regulated protein levels and inhibited enzymatic activities of STAT3-targeted molecules in melanoma cells. A375 and A2058 cells were treated with indicated concentrations of shikonin for 24 h, and then total cell lysates were collected, expression levels of (A) Mcl-1, Bcl-2, (B) MMP-2, (D) Twist, Vimentin, and N-cadherin were evaluated by Western blot analysis (left) and relative expression levels were analyzed by Image J software (right). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01. (C) The enzymatic activities of MMP-2 and MMP-9 were determined by gelatinase zymography.

    Journal: Frontiers in Pharmacology

    Article Title: Inhibition of the STAT3 Signaling Pathway Contributes to the Anti-Melanoma Activities of Shikonin

    doi: 10.3389/fphar.2020.00748

    Figure Lengend Snippet: Shikonin down-regulated protein levels and inhibited enzymatic activities of STAT3-targeted molecules in melanoma cells. A375 and A2058 cells were treated with indicated concentrations of shikonin for 24 h, and then total cell lysates were collected, expression levels of (A) Mcl-1, Bcl-2, (B) MMP-2, (D) Twist, Vimentin, and N-cadherin were evaluated by Western blot analysis (left) and relative expression levels were analyzed by Image J software (right). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01. (C) The enzymatic activities of MMP-2 and MMP-9 were determined by gelatinase zymography.

    Article Snippet: Constitutively active STAT3 expression construct STAT3-C Flag pRc/CMV was obtained from Addgene (USA).

    Techniques: Expressing, Western Blot, Software, Zymography

    Overexpression of STAT3 in human melanoma A375 cells reduced shikonin-mediated cell growth, migration, and invasion inhibition. A375 cells were transiently transfected with an empty vector or a STAT3C-expressing construct for 24 h, and then (A) the expression level of STAT3 in A375-STAT3C cells and A375-EV cells were examined by immunoblotting. (B–D) A375-EV or A375-STAT3C cells were incubated with shikonin for 48 h or 24 h, and then (B) cell proliferation, (C) cell migratory, and (D) cell invasive abilities were measured. Representative photographs of migrated cells (left) and quantification of these cells (right) were shown. Data were mean ± SD from three independent experiments, ## P < 0.01, * P < 0.05, and ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Inhibition of the STAT3 Signaling Pathway Contributes to the Anti-Melanoma Activities of Shikonin

    doi: 10.3389/fphar.2020.00748

    Figure Lengend Snippet: Overexpression of STAT3 in human melanoma A375 cells reduced shikonin-mediated cell growth, migration, and invasion inhibition. A375 cells were transiently transfected with an empty vector or a STAT3C-expressing construct for 24 h, and then (A) the expression level of STAT3 in A375-STAT3C cells and A375-EV cells were examined by immunoblotting. (B–D) A375-EV or A375-STAT3C cells were incubated with shikonin for 48 h or 24 h, and then (B) cell proliferation, (C) cell migratory, and (D) cell invasive abilities were measured. Representative photographs of migrated cells (left) and quantification of these cells (right) were shown. Data were mean ± SD from three independent experiments, ## P < 0.01, * P < 0.05, and ** P < 0.01.

    Article Snippet: Constitutively active STAT3 expression construct STAT3-C Flag pRc/CMV was obtained from Addgene (USA).

    Techniques: Over Expression, Migration, Inhibition, Transfection, Plasmid Preparation, Expressing, Construct, Western Blot, Incubation